caronhorton caronhorton

20-10-2020
Chemistry

contestada

Pls help!!!!!

The exact positions of the electrons in an atom cannot be determined because electrons are always what
1.moving
2.sharing
3.changing

Respuesta :

esval09 esval09

20-10-2020

Answer:

moving i think! Hope this helps

Explanation:

Answer Link

CleverCucumber CleverCucumber

20-10-2020

The exact positions of the electrons in an atom cannot be determined because electrons are always .

Answer Link

Otras preguntas

A device called an oscilloscope can be used to demonstrate: A. waveforms. B. nodeforms. C. sound forms. D. microphones.

Vitamin C ascorbic acid (C6F1806), is a reducing agent. One way to determine the ascorbic acid content of a sample is to mix the acid with an excess of iodine C

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

The ages of some lecturers are 42,54,50,42,46,46,48 and 48 calculate the standard deviation

in a class of 40 students, 30 students read chemistry, 40 students read physics, if all students read at least one of the subject, find the probability a stud

When studying a political speech, students can try to determine bias by

A recipe for making popcorn requires 2 tablespoons of butter for every 1/3 cup of popcorn kernels. At this rate, how much butter is required if 2 cups of popcor

There are five basic health-related components that one must have in order to be physically fit.O TrueO False

If x= 4y + 3 and y = -2x - 3, what is the value of xy?

The Atlantic Division of Stark Productions Company reported the following results for 2016: Sales $4,000,000 Variable costs 3,200,000 Controllable fixed costs 3