kubrxnurk kubrxnurk

18-09-2020
Mathematics

contestada

Can someone help me out? Just a little confused

Can someone help me out Just a little confused class=

Respuesta :

mhanifa mhanifa

18-09-2020

Answer:

Option D

Step-by-step explanation:

The volume is the product of three dimensions of the prism:

V = bh = lwh

So the option D is correct

(4x3)x2

Answer Link

Otras preguntas

What kind of printing was invented by the Tang Dynasty

What effect did the steam engine have on skilled workers?

The establishment of the European Union has created more boundaries within Europe then in the past true or false

who is the dilation of the triangle? #geometry #triangles

List the three symbiotic relationships

Help me please. thank you.

estimate the product of

Can someone explain how the imperfect is used to talk about the past?

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

Muhammad's revelations were eventually written down in the ______, the islamic holy book. a. bible b. torah c. qur'an d. dhammapada