sh3aayawalktone
sh3aayawalktone sh3aayawalktone
  • 18-03-2016
  • Biology
contestada

When you heat up an object, the particles in the object move which way?

Respuesta :

Hagrid
Hagrid Hagrid
  • 18-03-2016

When you heat up an object, the particles in the object move away from the heat source. The heat energy form the source transfers to the particles which causes them to be excited to move and go in any direction away from the source. It increases the kinetic energy of the particles.

Answer Link

Otras preguntas

carlos borrowed 26,000 for a car for 5 years at an APR of 5.52%. what will his monthly payment be ?
Each small square represents 1 square centimeter. What is the volume of this solid?
How do I solve this I don't no how to do this find the slope
how did buchanan and douglas respond to the lecompton constitution
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
How did the location of the Gobi and Taklamakan Deserts, the Himalaya Mountains, and the Pacific Ocean impact early settlement in China? A. It meant early peopl
Why might native hunters in the artic want to help catch and release narwhals
Use the graph of y=Caˣ to determine C and a.
Compare the physical features of Mexico with the place you live. In what ways is it the same? In what ways is it different? I live in Arizona.
Which number is greater: 3 x 10-¹² or 9 x 10-¹¹? How many times as great